Description:
HTT-Q39-PCDNA3.1, 1-90, L4A
Repository
|
HD Community Biorepository
|
Quantity |
20 µg |
Quantitation Method |
Please see our FAQ |
Certain Third Party Licensing Requirements |
Invitrogen License for Cat# V790.20 |
Alias
|
Htt-Q39-pcDNA3.1, 1-90, L4A
|
Family History
|
N
|
Remarks
|
|
Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a L4A mutation |
Construct Name |
Htt-Q39-pcDNA3.1, 1-90, L4A |
Insert Length |
351 |
Vector |
pcDNA3.1 |
Concentration |
793 ng/mL |
Sequence |
GGTACCGCCGCCACCatggcgaccgctgaaaagctgatgaaggccttcgagtccctcaa gtccttccaacagcagcaacagcaacaacagcagcaacagcaacaacagcagcaacagc aacaacagcagcaacaacag cagcaacagcaacaacagcagcaacagcaacaacagCa gcagcaaccgccaccgccgccgccgccgccgccgcctcctcagcttcctcagccgccgc cgcaggcacagccgctgctgcctcagccgcagccgcccccgccgcc gcccccgccgcc acccggcccggctgtggctgaggagccgctgcaccgaccaggatcctgataaTCTAGA
|
Cloning Information |
|
Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a L4A mutation |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a L4A mutation |
Remarks |
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin gene (Htt) containing 39 polyglutamine repeats and a L4A mutation |
PDF |
Vector Map |
|
Plasmid Collection Screening and Propagation |
Supplement |
- |
|